Mutants (Isolated)

tm1916

Allele Nametm1916
Sequence NameY48G1C.2
CGC Namecsk-1
Worm BaseAllele Name tm1916
CGC Name csk-1
Sequence Y48G1C.2
Phenotypelethal or sterile. Dr. M. Sundaram: larval lethal, complements let-124 (cs73). Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL.
Mutation site27229/27230-27742/27743 (513 bp deletion)
ChromosomeI
Putative gene structurejoin(25160..25408, 25452..25528, 26116..26277, 27136..27319, 27682..28001, 28462..28623, 29460..29664, 30224..30310, 31824..31958, 32817..32855)
Map position-20.48
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntFwd:CCTAGTACGTGAATCCACAA,ExtRev:GCCGGAGGTACAGTAACCAC,IntRev:AGCTGTGTGCCTGAAGCATT,ExtFwd:CCGGACGGAACCTTCCTAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Takata N, Itoh B, Misaki K, Hirose T, Yonemura S, Okada M.
Non-receptor tyrosine kinase CSK-1 controls pharyngeal muscle organization in Caenorhabditis elegans.
Genes Cells 2009 14(3) 381-93 
[ PubMed ID = 19210548 ] [ RRC reference ]