Mutants (Isolated)

tm1912

Allele Nametm1912
Sequence NameK02F3.10
CGC Namemoma-1
Worm BaseAllele Name tm1912
CGC Name moma-1
Sequence K02F3.10
Phenotypehomozygous viable
Mutation site28326/28327-29403/29404 (1077 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(28742..28791, 28841..29129, 29426..29692))
Map position-25.76
Balancer
Map position of balancer
Sequence of primersExtFwd:TCGCCTTCTCACCAGAGATG,IntFwd:ACCAGAGATGTGCTGCACCT,ExtRev:CTGTCCCATTCCAGCGTAGA,IntRev:CAGTCCACCACCACATCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Head BP, Zulaika M, Ryazantsev S, van der Bliek AM.
A novel mitochondrial outer membrane protein, MOMA-1, that affects cristae morphology in Caenorhabditis elegans.
Mol. Biol. Cell 2011 22(6) 831-41 
[ PubMed ID = 21248201 ] [ RRC reference ]