Mutants (Isolated)

tm1910

Allele Nametm1910
Sequence NameB0393.2
CGC Namerbg-3
Worm BaseAllele Name tm1910
CGC Name rbg-3
Sequence B0393.2
Phenotypehomozygous viable. Dr. P. Sengupta: normal dye filling.
Mutation site3654/3655-4319/4320 (665 bp deletion)
ChromosomeIII
Putative gene structurejoin(3027..3070, 3117..3225, 3277..3773, 3817..4050, 4096..4238, 4287..4393, 4439..4823, 4903..5069, 5117..5188)
Map position-2.61
Balancer
Map position of balancer
Sequence of primersExtRev:CCTGTTCATTCAGTCGAGTC,IntRev:GGGGAGTCCTCAATGGTTCT,ExtFwd:CCGCCTGACATATTACCTTA,IntFwd:TGGCTGCTGGCTTGGACTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell. Signal. 2014 26(1) 19-31 
[ PubMed ID = 24056045 ] [ RRC reference ]