| Allele Name | tm1909 |
| Sequence Name | BE0003N10.2 |
| CGC Name | chin-1 |
| Worm Base | Allele Name |
tm1909
|
| CGC Name |
chin-1
|
| Sequence |
BE0003N10.2
|
| Phenotype | lethal or sterile |
| Mutation site | 5703/5704-6457/6458 (754 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(1632..1947, 2654..3027, 3444..3594, 4864..5012, 5342..5458, 5507..5652, 5738..5768)) |
| Map position | -24.79 |
| Balancer | Not Yet Balanced |
| Map position of balancer | |
| Sequence of primers | ExtRev:GACGCTGACGGTCTGGAATT,IntRev:CTTGTAGCGGTACTCCACTA,ExtFwd:AGGTTCCCCGGGAAAATGGT,IntFwd:CGGCCTATTTTTCGCTAATG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Rapti G, Li C, Shan A, Lu Y, Shaham S.
Glia initiate brain assembly through noncanonical Chimaerin-Furin axon guidance in C. elegans.
Nat Neurosci 2017 20(10) 1350-1360
[ PubMed ID = 28846083 ]
[ RRC reference ]
|
Sailer A, Anneken A, Li Y, Lee S, Munro E.
Dynamic Opposition of Clustered Proteins Stabilizes Cortical Polarity in the C. elegans Zygote.
Dev Cell 2015 35(1) 131-42
[ PubMed ID = 26460948 ]
[ RRC reference ]
|
Kumfer KT, Cook SJ, Squirrell JM, Eliceiri KW, Peel N, O'Connell KF, White JG.
CGEF-1 and CHIN-1 regulate CDC-42 activity during asymmetric division in the Caenorhabditis elegans embryo.
Mol Biol Cell 2010 21(2) 266-77
[ PubMed ID = 19923324 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.