Mutants (Isolated)

tm1909

Allele Nametm1909
Sequence NameBE0003N10.2
CGC Namechin-1
Worm BaseAllele Name tm1909
CGC Name chin-1
Sequence BE0003N10.2
Phenotypelethal or sterile
Mutation site5703/5704-6457/6458 (754 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(1632..1947, 2654..3027, 3444..3594, 4864..5012, 5342..5458, 5507..5652, 5738..5768))
Map position-24.79
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:GACGCTGACGGTCTGGAATT,IntRev:CTTGTAGCGGTACTCCACTA,ExtFwd:AGGTTCCCCGGGAAAATGGT,IntFwd:CGGCCTATTTTTCGCTAATG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rapti G, Li C, Shan A, Lu Y, Shaham S.
Glia initiate brain assembly through noncanonical Chimaerin-Furin axon guidance in C. elegans.
Nat Neurosci 2017 20(10) 1350-1360 
[ PubMed ID = 28846083 ] [ RRC reference ]

Sailer A, Anneken A, Li Y, Lee S, Munro E.
Dynamic Opposition of Clustered Proteins Stabilizes Cortical Polarity in the C. elegans Zygote.
Dev Cell 2015 35(1) 131-42 
[ PubMed ID = 26460948 ] [ RRC reference ]

Kumfer KT, Cook SJ, Squirrell JM, Eliceiri KW, Peel N, O'Connell KF, White JG.
CGEF-1 and CHIN-1 regulate CDC-42 activity during asymmetric division in the Caenorhabditis elegans embryo.
Mol Biol Cell 2010 21(2) 266-77 
[ PubMed ID = 19923324 ] [ RRC reference ]