Mutants (Isolated)

tm1906

Allele Nametm1906
Sequence NameC27A12.10
CGC Namembd-2
Worm BaseAllele Name tm1906
CGC Name mbd-2
Sequence C27A12.10
Phenotypelethal or sterile
Mutation site27135/27136-TAGGAAGAATCC-28912/28913 (1777 bp deletion + 11 bp insertion)
ChromosomeI
Putative gene structurejoin(27572..27751, 27884..28009, 28137..28361, 28544..28645)
Map position0.74
BalancerhT2
Map position of balancer
Sequence of primersExtRev:TATCGAACGGGATGTGGTCT,IntFwd:ACACGAGAGTAACGAGTGAT,ExtFwd:AACGGTTTCCGAGGGCGCAA,IntRev:ATTCCGATGGGAGTGCCAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ihara S, Nakayama S, Murakami Y, Suzuki E, Asakawa M, Kinoshita T, Sawa H.
PIGN prevents protein aggregation in the endoplasmic reticulum independently of its function in the GPI synthesis.
J Cell Sci 2017 130(3) 602-613 
[ PubMed ID = 27980068 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]