| Allele Name | tm1900 |
| Sequence Name | F14H12.4a |
| CGC Name | cst-1 |
| Worm Base | Allele Name |
tm1900
|
| CGC Name |
cst-1
|
| Sequence |
F14H12.4a
|
| Phenotype | homozygous viable. Dr. M. Han: no obvious heterochronic phenotype such as alae gaps. Dr. H. Suzuki: normal chemotaxis to NaCl. Dr. M. Bastiani: no axon regeneratio phenotype. |
| Mutation site | 5898/5899-6476/6477 (578 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(6145..6278, 6345..6425, 6472..6652, 6925..7080, 7123..7500, 8387..8479, 8528..8618, 8788..8868, 8911..9078, 9422..9486, 9534..9622, 10037..10097) |
| Map position | -7.76 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACAAGCAGAGTGCATGTGCA,IntRev:TACCTCACACAATCGGAGTG,ExtRev:AAGCCATACGTACCTCACAC,IntFwd:CGCAGAGAAACATGCGACTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wilkinson DS, Jariwala JS, Anderson E, Mitra K, Meisenhelder J, Chang JT, Ideker T, Hunter T, Nizet V, Dillin A, Hansen M.
Phosphorylation of LC3 by the Hippo kinases STK3/STK4 is essential for autophagy.
Mol Cell 2015 57(1) 55-68
[ PubMed ID = 25544559 ]
[ RRC reference ]
|
Feng G, Zhu Z, Li WJ, Lin Q, Chai Y, Dong MQ, Ou G.
Hippo kinases maintain polarity during directional cell migration in Caenorhabditis elegans.
EMBO J 2017 36(3) 334-345
[ PubMed ID = 28011581 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.