Mutants (Isolated)

tm1900

Allele Nametm1900
Sequence NameF14H12.4a
CGC Namecst-1
Worm BaseAllele Name tm1900
CGC Name cst-1
Sequence F14H12.4a
Phenotypehomozygous viable. Dr. M. Han: no obvious heterochronic phenotype such as alae gaps. Dr. H. Suzuki: normal chemotaxis to NaCl. Dr. M. Bastiani: no axon regeneratio phenotype.
Mutation site5898/5899-6476/6477 (578 bp deletion)
ChromosomeX
Putative gene structurejoin(6145..6278, 6345..6425, 6472..6652, 6925..7080, 7123..7500, 8387..8479, 8528..8618, 8788..8868, 8911..9078, 9422..9486, 9534..9622, 10037..10097)
Map position-7.76
Balancer
Map position of balancer
Sequence of primersExtFwd:ACAAGCAGAGTGCATGTGCA,IntRev:TACCTCACACAATCGGAGTG,ExtRev:AAGCCATACGTACCTCACAC,IntFwd:CGCAGAGAAACATGCGACTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wilkinson DS, Jariwala JS, Anderson E, Mitra K, Meisenhelder J, Chang JT, Ideker T, Hunter T, Nizet V, Dillin A, Hansen M.
Phosphorylation of LC3 by the Hippo kinases STK3/STK4 is essential for autophagy.
Mol Cell 2015 57(1) 55-68 
[ PubMed ID = 25544559 ] [ RRC reference ]

Feng G, Zhu Z, Li WJ, Lin Q, Chai Y, Dong MQ, Ou G.
Hippo kinases maintain polarity during directional cell migration in Caenorhabditis elegans.
EMBO J 2017 36(3) 334-345 
[ PubMed ID = 28011581 ] [ RRC reference ]