Mutants (Isolated)

tm1896

Allele Nametm1896
Sequence NameT16H5.1
CGC Nameinx-19
Worm BaseAllele Name tm1896
CGC Name inx-19
Sequence T16H5.1
Phenotypehomozygous viable. Dr. H. Sawa: Some die in embryonic stage (10/100). Dr. C. Bargmann: Cell 129, 787 (2007)
Mutation site2908/2909-3454/3455 (546 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(169..372, 1137..1547, 2853..3089, 3214..3287, 4249..4658, 11541..11569))
Map position-8.61
Balancer
Map position of balancer
Sequence of primersIntFwd:GAGGCACGCATTGAGTATCA,ExtFwd:GCTACTTTTGAGGCACGCAT,IntRev:ATAGGTGGCCGAACCGTTCT,ExtRev:CATTCTGTGCCTGGGAGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chuang CF, Vanhoven MK, Fetter RD, Verselis VK, Bargmann CI.
An innexin-dependent cell network establishes left-right neuronal asymmetry in C. elegans.
Cell 2007 129(4) 787-99 
[ PubMed ID = 17512411 ] [ RRC reference ]

Altun ZF, Chen B, Wang ZW, Hall DH.
High resolution map of Caenorhabditis elegans gap junction proteins.
Dev. Dyn. 2009 238(8) 1936-50 
[ PubMed ID = 19621339 ] [ RRC reference ]

Starich TA, Xu J, Skerrett IM, Nicholson BJ, Shaw JE.
Interactions between innexins UNC-7 and UNC-9 mediate electrical synapse specificity in the Caenorhabditis elegans locomotory nervous system.
Neural Dev 2009 4 16 
[ PubMed ID = 19432959 ] [ RRC reference ]

Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW.
Six innexins contribute to electrical coupling of C. elegans body-wall muscle.
PLoS ONE 2013 8(10) e76877 
[ PubMed ID = 24130800 ] [ RRC reference ]

Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI.
Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(7) E1263-E1272 
[ PubMed ID = 28143932 ] [ RRC reference ]