Mutants (Isolated)

tm1892

Allele Name

tm1892

Allele Type

Normal

Sequence Name

C02B10.2

Gene Name

WBGene00015327

Worm Base

Allele Name

tm1892

Gene Name

WBGene00015327

Sequence

C02B10.2

Phenotype

homozygous viable. Dr. R.M. Saito: not Elm.

Mutation site

19978/19979-20498/20499 (520 bp deletion)

Chromosome

Putative gene structure

complement(join(19746..19862, 19908..20006, 20049..20201))

Map position

1.44

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TTGCCGCATCAGACAGGGTT,IntFwd:CTAGAAGCGGATGGTGAGTG,ExtRev:GACGCGCATGTTCTTTGCTT,IntRev:TACTGGATGCCTGACGGATA

Distributed lab

Dr. Mario de Bono(2011/12),Dr. Antony Page(2021/2),Dr. Joshua Kaplan(2012/3),Dr. Christopher Rongo(2005/6),Dr. Kang Shen(2016/4),Dr. Janet E. Richmond(2007/1),Dr. Greg Hermann(2010/2),Dr. S. L'Hernault(2008/4),Dr. Martin Chalfie(2023/11),Dr. M. Nonet(2005/6),Dr. R. Mako Saito(2006/2),Dr. Chonglin Yang(2015/4),Dr. Xiaochen Wang(2021/5),Dr. ZhengXing Wu(2007/4),Dr. Hongkyun Kim(2023/11),Dr. Daniel Colon-Ramos(2016/10),Dr. Gawain McColl(19/6),Dr. Zu-hang Sheng(2012/9),Dr. Dengke Ma(2018/4),Dr. Shinsuke Niwa(2017/2),Dr. Anbing Shi(2024/7),Dr. Alexandre Benedetto(2021/9)

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Morris C, Foster OK, Handa S, Peloza K, Voss L, Somhegyi H, Jian Y, Vo MV, Harp M, Rambo FM, Yang C, Hermann GJ.
Function and regulation of the Caenorhabditis elegans Rab32 family member GLO-1 in lysosome-related organelle biogenesis.
PLoS Genet 2018 14(11) e1007772
[ PubMed ID = 30419011 ] [ RRC reference ]

Niwa S, Tao L, Lu SY, Liew GM, Feng W, Nachury MV, Shen K.
BORC Regulates the Axonal Transport of Synaptic Vesicle Precursors by Activating ARL-8.
Curr Biol 2017 27(17) 2569-2578.e4
[ PubMed ID = 28823680 ] [ RRC reference ]

Yu SC, Klosterman SM, Martin AA, Gracheva EO, Richmond JE.
Differential roles for snapin and synaptotagmin in the synaptic vesicle cycle.
PLoS One 2013 8(2) e57842
[ PubMed ID = 23469084 ] [ RRC reference ]

Hermann GJ, Scavarda E, Weis AM, Saxton DS, Thomas LL, Salesky R, Somhegyi H, Curtin TP, Barrett A, Foster OK, Vine A, Erlich K, Kwan E, Rabbitts BM, Warren K.
C. elegans BLOC-1 functions in trafficking to lysosome-related gut granules.
PLoS One 2012 7(8) e43043
[ PubMed ID = 22916203 ] [ RRC reference ]

Sato K, Norris A, Sato M, Grant BD.
C. elegans as a model for membrane traffic.
WormBook 2014 1-47
[ PubMed ID = 24778088 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96
[ PubMed ID = 24501423 ] [ RRC reference ]