Mutants (Isolated)

tm1890

Allele Nametm1890
Sequence NameC10F3.2
CGC Namedhs-16
Worm BaseAllele Name tm1890
CGC Name dhs-16
Sequence C10F3.2
Phenotypehomozygous viable. Dr. A. Antebi: gonadal Mig on low cholesterol. Dr. C. Loer: not serotonin deficient nor alkaline bleach hypersensitive.
Mutation site23034/23035-23641/23642 (607 bp deletion)
ChromosomeV
Putative gene structurejoin(23219..23419, 23758..24328, 24415..24809)
Map position-0.47
Balancer
Map position of balancer
Sequence of primersIntFwd:TCCTAGATAGGTGGAGGGTA,ExtFwd:CAGGGCGGAGCATACCTATT,IntRev:GAATCGCAGAACGACGCTTC,ExtRev:CGATATCAAGTACGGTGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wollam J, Magner DB, Magomedova L, Rass E, Shen Y, Rottiers V, Habermann B, Cummins CL, Antebi A.
A novel 3-hydroxysteroid dehydrogenase that regulates reproductive development and longevity.
PLoS Biol. 2012 10(4) e1001305 
[ PubMed ID = 22505847 ] [ RRC reference ]

Mahanti P, Bose N, Bethke A, Judkins JC, Wollam J, Dumas KJ, Zimmerman AM, Campbell SL, Hu PJ, Antebi A, Schroeder FC.
Comparative metabolomics reveals endogenous ligands of DAF-12, a nuclear hormone receptor, regulating C. elegans development and lifespan.
Cell Metab. 2014 19(1) 73-83 
[ PubMed ID = 24411940 ] [ RRC reference ]