Mutants (Isolated)

tm1888

Allele Name

tm1888

Sequence Name

F13B12.5

CGC Name

ins-1

Worm Base

Allele Name

tm1888

CGC Name

ins-1

Sequence

F13B12.5

Phenotype

homozygous viable. Dr. S. Tuck: does not affect rsks-1 gene. L. Avery: intact satiety behavior. Dr. S. Tuck: Cell 128, 577-587 (2007). Dr. Z-X. Wu: normal chemotaxis against glycerol, Cu and normal nose touch response.

Mutation site

21217/21218-21965/21966 (748 bp deletion)

Chromosome

Putative gene structure

join(20800..20825, 20912..21063, 21887..22038)

Map position

4.59

Balancer

Map position of balancer

Sequence of primers

IntRev:TCCGGTGAGCTGCCAACGAT,ExtRev:GGATGCATCAGACGACTGTG,IntFwd:GCAGACAGGAAATCATCTAC,ExtFwd:GTCCTGACTGCAAACGAGCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Saito R, Shinkai Y, Doi M.
Intestinal F-box protein regulates quick avoidance behavior of Caenorhabditis elegans to the pathogenic bacterium Pseudomonas aeruginosa.
Genes Cells 2019 24(3) 192-201
[ PubMed ID = 30589496 ] [ RRC reference ]

Dwyer DS, Aamodt EJ.
Insulin/IGF-1 signaling, including class II/III PI3Ks, β-arrestin and SGK-1, is required in C. elegans to maintain pharyngeal muscle performance during starvation.
PLoS One 2013 8(5) e63851
[ PubMed ID = 23700438 ] [ RRC reference ]

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R.
Dissecting the serotonergic food signal stimulating sensory-mediated aversive behavior in C. elegans.
PLoS One 2011 6(7) e21897
[ PubMed ID = 21814562 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J 2018 37(15)
[ PubMed ID = 29925517 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330
[ PubMed ID = 28131836 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79
[ PubMed ID = 24671950 ] [ RRC reference ]

Kao G, Nordenson C, Still M, Rönnlund A, Tuck S, Naredi P.
ASNA-1 positively regulates insulin secretion in C. elegans and mammalian cells.
Cell 2007 128(3) 577-87
[ PubMed ID = 17289575 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]