Mutants (Isolated)

tm1887

Allele Nametm1887
Sequence NameC41D11.1
CGC Nameeri-6
Worm BaseAllele Name tm1887
CGC Name eri-6
Sequence C41D11.1
Phenotypehomozygous viable. Dr. G. Ruvkun: no visible phenotypes.
Mutation site34154/34155-34990/34991 (836 bp deletion)
ChromosomeI
Putative gene structurejoin(34408..34592, 34661..34754, 34805..34917, 34967..35153, 35210..35348, 35399..35505, 35551..35688)
Map position-1.28
Balancer
Map position of balancer
Sequence of primersIntRev:GTGTACCTTCTTGCGGTACG,ExtFwd:CGTGTCGGTGCCAACACAAC,ExtRev:CCCAATAGGACGACGGTTTT,IntFwd:CCCGGTGGTCCTTGAATACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kumsta C, Hansen M.
C. elegans rrf-1 mutations maintain RNAi efficiency in the soma in addition to the germline.
PLoS ONE 2012 7(5) e35428 
[ PubMed ID = 22574120 ] [ RRC reference ]

Fischer SE, Butler MD, Pan Q, Ruvkun G.
Trans-splicing in C. elegans generates the negative RNAi regulator ERI-6/7.
Nature 2008 455(7212) 491-6 
[ PubMed ID = 18784652 ] [ RRC reference ]