Mutants (Isolated)

tm1885

Allele Nametm1885
Sequence NameF08A10.1c
CGC Namekcnl-2
Worm BaseAllele Name tm1885
CGC Name kcnl-2
Sequence F08A10.1c
Phenotypehomozygous viable. Dr. H. Sawa: non Psa.
Mutation site[T02E1] 2386/2387-[T02E1] 3348/3349 (962 bp deletion)
ChromosomeI
Putative gene structure[T02E1] join(1934..2486, 2604..2730, 2788..2876, 2926..3071, 3167..3405, 3451..3877, 3935..4062, 4113..4182, 4227..4362, 4786..4889)
Map position2.64
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTGTGATAATCCTCCAATC,IntFwd:TGTTCGAACTGTCGCCCAGT,ExtRev:GCACTCCTACCTGCTTAGTA,IntRev:GCACATGCTTCTCTGCCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chotoo CK, Silverman GA, Devor DC, Luke CJ.
A small conductance calcium-activated K+ channel in C. elegans, KCNL-2, plays a role in the regulation of the rate of egg-laying.
PLoS ONE 2013 8(9) e75869 
[ PubMed ID = 24040423 ] [ RRC reference ]

Dimitriadi M, Kye MJ, Kalloo G, Yersak JM, Sahin M, Hart AC.
The neuroprotective drug riluzole acts via small conductance Ca2+-activated K+ channels to ameliorate defects in spinal muscular atrophy models.
J. Neurosci. 2013 33(15) 6557-62 
[ PubMed ID = 23575853 ] [ RRC reference ]