Mutants (Isolated)

tm1883

Allele Nametm1883
Sequence NameH20J04.6
CGC NameH20J04.6
Worm BaseAllele Name tm1883
CGC Name H20J04.6
Sequence H20J04.6
Phenotypehomozygous viable
Mutation site1355/1356-1711/1712 (356 bp deletion)
ChromosomeII
Putative gene structurejoin(853..935, 988..1072, 1123..1248, 1297..1506)
Map position-4.88
Balancer
Map position of balancer
Sequence of primersExtRev:GTCAGATCGATGACATCGAA,IntRev:GATCCCTCGTCACTCCCATA,ExtFwd:GAGACTTTTTGCTCCCGCCT,IntFwd:GACTTATGCGCCTTTAGGAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gleason JE, Eisenmann DM.
Wnt signaling controls the stem cell-like asymmetric division of the epithelial seam cells during C. elegans larval development.
Dev Biol 2010 348(1) 58-66 
[ PubMed ID = 20849842 ] [ RRC reference ]