Mutants (Isolated)

tm1873

Allele Nametm1873
Sequence NameT20B12.8
CGC Namehmg-4
Worm BaseAllele Name tm1873
CGC Name hmg-4
Sequence T20B12.8
Phenotypelethal or sterile
Mutation site15542/15543-16712/16713 (1170 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(14284..14574, 14627..15554, 15617..16254, 16362..16598))
Map position-0.74
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CGTACAATCGAATACCGTAG,ExtRev:CAGGCGCTTCATCTTCTGAG,IntFwd:TCGTCTGGCTCTGATCCAGT,ExtFwd:CCGGCTCAGACTCTCCAGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kolundzic E, Ofenbauer A, Bulut SI, Uyar B, Baytek G, Sommermeier A, Seelk S, He M, Hirsekorn A, Vucicevic D, Akalin A, Diecke S, Lacadie SA, Tursun B.
FACT Sets a Barrier for Cell Fate Reprogramming in Caenorhabditis elegans and Human Cells.
Dev Cell 2018 46(5) 611-626.e12 
[ PubMed ID = 30078731 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]