Mutants (Isolated)

tm1865

Allele Nametm1865
Sequence NameF46F6.1
CGC Namerme-4
Worm BaseAllele Name tm1865
CGC Name rme-4
Sequence F46F6.1
Phenotypehomozygous viable. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. K. Sato: EMBO J, 27, 1183 (2008).
Mutation site[Y49A10A] 21927/21928-[Y49A10A] 22375/22376 (448 bp deletion)
ChromosomeX
Putative gene structure[Y49A10A] complement(join(21169..21574, 22138..22304, 22349..22405))
Map position1.98
Balancer
Map position of balancer
Sequence of primersIntFwd:CGTCGCAAATGGGTCGGCAA,ExtFwd:GGACCGATGAGCCAGGAATC,IntRev:CCCGAGTCTCTCGTCGACAT,ExtRev:AACTCAATGATGAGGACGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sato M, Sato K, Liou W, Pant S, Harada A, Grant BD.
Regulation of endocytic recycling by C. elegans Rab35 and its regulator RME-4, a coated-pit protein.
EMBO J. 2008 27(8) 1183-96 
[ PubMed ID = 18354496 ] [ RRC reference ]

Haley R, Wang Y, Zhou Z.
The small GTPase RAB-35 defines a third pathway that is required for the recognition and degradation of apoptotic cells.
PLoS Genet. 2018 14(8) e1007558 
[ PubMed ID = 30138370 ] [ RRC reference ]