Home > Mutants (Isolated) > tm1865

Mutants (Isolated)

Allele Name		tm1865
Allele Type		Normal
Sequence Name		F46F6.1
Gene Name		rme-4
Worm Base	Allele Name	tm1865
	Gene Name	rme-4
	Sequence	F46F6.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. K. Sato: EMBO J, 27, 1183 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[Y49A10A] 21927/21928-[Y49A10A] 22375/22376 (448 bp deletion)
Chromosome		X
Putative gene structure		[Y49A10A] complement(join(21169..21574, 22138..22304, 22349..22405))
Map position		1.98
Balancer
Map position of balancer
Sequence of primers		IntFwd:CGTCGCAAATGGGTCGGCAA,ExtFwd:GGACCGATGAGCCAGGAATC,IntRev:CCCGAGTCTCTCGTCGACAT,ExtRev:AACTCAATGATGAGGACGCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Haley R, Wang Y, Zhou Z. The small GTPase RAB-35 defines a third pathway that is required for the recognition and degradation of apoptotic cells. PLoS Genet 2018 14(8) e1007558  [ PubMed ID = 30138370 ] [ RRC reference ] Sato M, Sato K, Liou W, Pant S, Harada A, Grant BD. Regulation of endocytic recycling by C. elegans Rab35 and its regulator RME-4, a coated-pit protein. EMBO J 2008 27(8) 1183-96  [ PubMed ID = 18354496 ] [ RRC reference ]