Mutants (Isolated)

tm1863

Allele Nametm1863
Allele TypeNormal
Sequence NameB0041.2
Gene Nameain-2
Worm BaseAllele Name tm1863
Gene Name ain-2
Sequence B0041.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Han: WT vulval development, WT growth, WT adult alae, WT touch response.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12204/12205-12893/12894 (689 bp deletion)
ChromosomeI
Putative gene structurejoin(12233..12359, 12584..13321, 13374..13643, 14069..14350, 14802..15118, 15548..15625, 15872..16180)
Map position-1.03
Balancer
Map position of balancer
Sequence of primersIntRev:CACGTGACGAGCTTTGATCG,ExtFwd:TACTCTGGGTTTCACCTGCT,ExtRev:TCCCAACCACGTGACGAGCT,IntFwd:ACCGTACCCCTACCTTTGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kogure A, Uno M, Ikeda T, Nishida E.
The microRNA machinery regulates fasting-induced changes in gene expression and longevity in Caenorhabditis elegans.
J Biol Chem 2017 292(27) 11300-11309 
[ PubMed ID = 28507100 ] [ RRC reference ]

Kudlow BA, Zhang L, Han M.
Systematic analysis of tissue-restricted miRISCs reveals a broad role for microRNAs in suppressing basal activity of the C. elegans pathogen response.
Mol Cell 2012 46(4) 530-41 
[ PubMed ID = 22503424 ] [ RRC reference ]

Than MT, Kudlow BA, Han M.
Functional analysis of neuronal microRNAs in Caenorhabditis elegans dauer formation by combinational genetics and Neuronal miRISC immunoprecipitation.
PLoS Genet 2013 9(6) e1003592 
[ PubMed ID = 23818874 ] [ RRC reference ]

Ding XC, Grosshans H.
Repression of C. elegans microRNA targets at the initiation level of translation requires GW182 proteins.
EMBO J 2009 28(3) 213-22 
[ PubMed ID = 19131968 ] [ RRC reference ]

Zhang L, Ding L, Cheung TH, Dong MQ, Chen J, Sewell AK, Liu X, Yates JR 3rd, Han M.
Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2.
Mol Cell 2007 28(4) 598-613 
[ PubMed ID = 18042455 ] [ RRC reference ]