Mutants (Isolated)

tm1851

Allele Nametm1851
Sequence NameC11D2.6
CGC Nameunc-77
Worm BaseAllele Name tm1851
CGC Name unc-77
Sequence C11D2.6
Phenotypehomozygous viable
Mutation site19547/19548-20760/20761 (1213 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(9594..9704, 9753..9860, 9979..10065, 10472..10543, 10620..11013, 12018..12291, 12464..12599, 13169..13262, 13312..13468, 14178..15021, 15656..15833, 15935..16029, 16078..16209, 16638..16953, 17546..17728, 18097..18198, 18395..18515, 18724..18821, 18900..19078, 19273..19410, 19930..20424, 20672..21168, 21852..21967, 22050..22191, 22238..22337, 22619..22753, 22891..22955, 23402..23557, 25028..25088))
Map position3.05
Balancer
Map position of balancer
Sequence of primersIntRev:TGGAGGTTACGAATGTCCTG,ExtFwd:ACTCGAAGTCTCCATGGAAG,IntFwd:CGAACAGGGAGAGCACAATC,ExtRev:CTGGCGATTCCTGATACAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yue X, Zhao J, Li X, Fan Y, Duan D, Zhang X, Zou W, Sheng Y, Zhang T, Yang Q, Luo J, Duan S, Xiao R, Kang L.
TMC Proteins Modulate Egg Laying and Membrane Excitability through a Background Leak Conductance in C. elegans.
Neuron 2018 97(3) 571-585.e5 
[ PubMed ID = 29395910 ] [ RRC reference ]

Humphrey JA, Hamming KS, Thacker CM, Scott RL, Sedensky MM, Snutch TP, Morgan PG, Nash HA.
A putative cation channel and its novel regulator: cross-species conservation of effects on general anesthesia.
Curr. Biol. 2007 17(7) 624-9 
[ PubMed ID = 17350263 ] [ RRC reference ]

Speca DJ, Chihara D, Ashique AM, Bowers MS, Pierce-Shimomura JT, Lee J, Rabbee N, Speed TP, Gularte RJ, Chitwood J, Medrano JF, Liao M, Sonner JM, Eger EI 2nd, Peterson AS, McIntire SL.
Conserved role of unc-79 in ethanol responses in lightweight mutant mice.
PLoS Genet. 2010 6(8)  
[ PubMed ID = 20714347 ] [ RRC reference ]