Mutants (Isolated)

tm1849

Allele Nametm1849
Sequence NameZK1251.1
CGC NameZK1251.1
Worm BaseAllele Name tm1849
CGC Name ZK1251.1
Sequence ZK1251.1
Phenotypehomozygous viable
Mutation site11851/11852-GGGGGGGGG-12346/12347 (495 bp deletion + 9 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(11786..12145, 12214..12291))
Map position4.36
Balancer
Map position of balancer
Sequence of primersIntRev:GTTGAGCAGCTCATTAACTC,ExtRev:CCTTGCCTGAGTCACCTAAA,IntFwd:GTGAACCGACTAGGCTGCGA,ExtFwd:GCCCTCTTGTGACTAAAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murphy CT, Lee SJ, Kenyon C.
Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2007 104(48) 19046-50 
[ PubMed ID = 18025456 ] [ RRC reference ]