Mutants (Isolated)

tm1848

Allele Nametm1848
Sequence NameC18B12.2
CGC Nameseb-3
Worm BaseAllele Name tm1848
CGC Name seb-3
Sequence C18B12.2
Phenotypehomozygous viable
Mutation site22567/22568-23332/23333 (765 bp deletion)
ChromosomeX
Putative gene structurejoin(20131..20207, 20514..20635, 22092..22210, 22258..22371, 22429..22569, 23141..23443, 23492..23577, 23911..24037, 24086..24180, 24229..24364, 24560..24604)
Map position21.8
Balancer
Map position of balancer
Sequence of primersExtFwd:GCCGCACTATACAAGCCCGA,IntFwd:CAGATACATGGTTTCCCGGA,ExtRev:GCGCTCCCTGGATTTCACTA,IntRev:ATAGCCGAGCCGAGCATGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jee C, Lee J, Lim JP, Parry D, Messing RO, McIntire SL.
SEB-3, a CRF receptor-like GPCR, regulates locomotor activity states, stress responses and ethanol tolerance in Caenorhabditis elegans.
Genes Brain Behav. 2013 12(2) 250-62 
[ PubMed ID = 22853648 ] [ RRC reference ]