Mutants (Isolated)

tm1846

Allele Nametm1846
Sequence NameF01E11.5
CGC Nametyra-2
Worm BaseAllele Name tm1846
CGC Name tyra-2
Sequence F01E11.5
Phenotypehomozygous viable. Dr. H. R. Horvitz: normal serotonin resistance. Dr. K. Ashrafi: Cell Metab 8, 118 (2008).
Mutation site36937/36938-37356/37357 (419 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(32555..32635,32688..32799,32847..32978, 33033..33223, 33270..33370, 34314..34413, 36372..36566, 36613..36800, 37061..37181, 37230..37475))
Map position-1.93
Balancer
Map position of balancer
Sequence of primersIntFwd:TACATGAGACGAGACGGCCA,ExtFwd:GTGCTCTATAGCTATGGGGA,IntRev:GCAGTCCCGGATTTTATTTG,ExtRev:GTCGACAACATGGGAGTTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Noble T, Stieglitz J, Srinivasan S.
An integrated serotonin and octopamine neuronal circuit directs the release of an endocrine signal to control C. elegans body fat.
Cell Metab. 2013 18(5) 672-84 
[ PubMed ID = 24120942 ] [ RRC reference ]

Fu J, Zhang H, Huang W, Zhu X, Sheng Y, Song E, Xu T.
AIM interneurons mediate feeding suppression through the TYRA-2 receptor in C. elegans.
Biophys Rep 2018 4(1) 17-24 
[ PubMed ID = 29577066 ] [ RRC reference ]

Wragg RT, Hapiak V, Miller SB, Harris GP, Gray J, Komuniecki PR, Komuniecki RW.
Tyramine and octopamine independently inhibit serotonin-stimulated aversive behaviors in Caenorhabditis elegans through two novel amine receptors.
J. Neurosci. 2007 27(49) 13402-12 
[ PubMed ID = 18057198 ] [ RRC reference ]

Greer ER, Pérez CL, Van Gilst MR, Lee BH, Ashrafi K.
Neural and molecular dissection of a C. elegans sensory circuit that regulates fat and feeding.
Cell Metab. 2008 8(2) 118-31 
[ PubMed ID = 18680713 ] [ RRC reference ]

Law W, Wuescher LM, Ortega A, Hapiak VM, Komuniecki PR, Komuniecki R.
Heterologous Expression in Remodeled C. elegans: A Platform for Monoaminergic Agonist Identification and Anthelmintic Screening.
PLoS Pathog. 2015 11(4) e1004794 
[ PubMed ID = 25928899 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res. 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]