Mutants (Isolated)

tm1845

Allele Nametm1845
Sequence NameB0240.4
CGC Namenpp-22
Worm BaseAllele Name tm1845
CGC Name npp-22
Sequence B0240.4
Phenotypehomozygous viable. Dr. V. Cordes: J.C.Biol. 173, 509-519 (2006)
Mutation site15119/15120-GTCAACATAAAATGGTACAGCTGCTCCTTTAACTCCTTTTCCAATGATAGAAGGTAAAGAACATACT-16104/16105 (985 bp deletion + 67 bp insertion)
ChromosomeV
Putative gene structurecomplement(join(14506..14572, 14619..14719, 14823..15497, 15556..15813, 15862..16085, 16130..16234, 16282..16541, 16584..16660))
Map position3.32
Balancer
Map position of balancer
Sequence of primersExtFwd:GTTTACAGAGCAGCGTGATG,ExtRev:CGGGATTGAGCTATACTATG,IntRev:CGCAGTAACCACTGTCGTCT,IntFwd:TATAAAGCCTCAGCGGCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stavru F, Hülsmann BB, Spang A, Hartmann E, Cordes VC, Görlich D.
NDC1: a crucial membrane-integral nucleoporin of metazoan nuclear pore complexes.
J. Cell Biol. 2006 173(4) 509-19 
[ PubMed ID = 16702233 ] [ RRC reference ]

Gorjánácz M, Jaedicke A, Mattaj IW.
What can Caenorhabditis elegans tell us about the nuclear envelope?
FEBS Lett. 2007 581(15) 2794-801 
[ PubMed ID = 17418822 ] [ RRC reference ]

Askjaer P, Galy V, Meister P.
Modern tools to study nuclear pore complexes and nucleocytoplasmic transport in Caenorhabditis elegans.
Methods Cell Biol. 2014 122 277-310 
[ PubMed ID = 24857735 ] [ RRC reference ]