Mutants (Isolated)

tm1842

Allele Name

tm1842

Sequence Name

F45G2.3

CGC Name

exo-1

Worm Base

Allele Name

tm1842

CGC Name

exo-1

Sequence

F45G2.3

Phenotype

homozygous viable. Dr. A. Gartner: no radiation sensitivity. Dr. K. Nishiwaki: normal DTC migration. Dr. S. Boulton: not required for the S-phase checkpoint.

Mutation site

17446/17447-18005/18006 (559 bp deletion)

Chromosome

III

Putative gene structure

join(17200..17247, 17295..17504, 17561..18001, 18071..18358, 18412..18507, 18563..18636, 18687..18768, 18818..19305, 19367..19559)

Map position

21.21

Balancer

Map position of balancer

Sequence of primers

IntRev:GATTGAGAAGCGGCGATTGA,ExtRev:TCTATCCGGCAACGACGGAG,IntFwd:CGTCTCTATGCATTTACGCT,ExtFwd:GCCGACTGTGGCGTCTCTAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Ryu JS, Koo HS.
The Caenorhabditis elegans WRN helicase promotes double-strand DNA break repair by mediating end resection and checkpoint activation.
FEBS Lett. 2017 591(14) 2155-2166
[ PubMed ID = 28640365 ] [ RRC reference ]

Yin Y, Smolikove S.
Impaired resection of meiotic double-strand breaks channels repair to nonhomologous end joining in Caenorhabditis elegans.
Mol. Cell. Biol. 2013 33(14) 2732-47
[ PubMed ID = 23671188 ] [ RRC reference ]

Girard C, Roelens B, Zawadzki KA, Villeneuve AM.
Interdependent and separable functions of Caenorhabditis elegans MRN-C complex members couple formation and repair of meiotic DSBs.
Proc. Natl. Acad. Sci. U.S.A. 2018 115(19) E4443-E4452
[ PubMed ID = 29686104 ] [ RRC reference ]

SenGupta T, Torgersen ML, Kassahun H, Vellai T, Simonsen A, Nilsen H.
Base excision repair AP endonucleases and mismatch repair act together to induce checkpoint-mediated autophagy.
Nat Commun 2013 4 2674
[ PubMed ID = 24154628 ] [ RRC reference ]

Lemmens BB, Johnson NM, Tijsterman M.
COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining.
PLoS Genet. 2013 9(2) e1003276
[ PubMed ID = 23408909 ] [ RRC reference ]

van Schendel R, Roerink SF, Portegijs V, van den Heuvel S, Tijsterman M.
Polymerase Θ is a key driver of genome evolution and of CRISPR/Cas9-mediated mutagenesis.
Nat Commun 2015 6 7394
[ PubMed ID = 26077599 ] [ RRC reference ]

O'Neil NJ, Martin JS, Youds JL, Ward JD, Petalcorin MI, Rose AM, Boulton SJ.
Joint molecule resolution requires the redundant activities of MUS-81 and XPF-1 during Caenorhabditis elegans meiosis.
PLoS Genet. 2013 9(7) e1003582
[ PubMed ID = 23874209 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480
[ PubMed ID = 28934497 ] [ RRC reference ]