Mutants (Isolated)

tm1840

Allele Nametm1840
Sequence NameZK256.1
CGC Namepmr-1
Worm BaseAllele Name tm1840
CGC Name pmr-1
Sequence ZK256.1
Phenotypehomozygous viable
Mutation site[CC4] 23553/23554-A-[CC4] 24064/24065 (511 bp deletion + 1 bp insertion)
ChromosomeI
Putative gene structurejoin(Z81490.1:23740..24051, Z81490.1:24897..25127, Z81490.1:25190..25465, Z81490.1:26681..27254, Z81490.1:30707..31009, Z81490.1:31777..32063, 104..201, 1046..1310, 1948..2188, 2734..2852)
Map position17.16
Balancer
Map position of balancer
Sequence of primersExtFwd:GACGGCGGCAATATTCCGAG,IntFwd:CCGAGTACAAGGTAACACTA,ExtRev:CCCATGAAGGCGATGCATGT,IntRev:CAACATCGGATCCGGTGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]