Mutants (Isolated)

tm1832

Allele Nametm1832
Sequence NameF13B9.8
CGC Namefis-2
Worm BaseAllele Name tm1832
CGC Name fis-2
Sequence F13B9.8
Phenotypehomozygous viable. Dr. H-S. Koo: no lethality after outcrossed several times.
Mutation site21683/21684-23100/23101 (1417 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(21315..21400, 21687..21872, 22526..22658, 22719..22730))
Map position-0.19
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTAACAAATCAGGCCGTAA,IntFwd:GTCCGGCAAGTGCAAGTGCT,ExtRev:GCGATCCGAAAACGATAGCT,IntRev:CATCTATGGCGCGAATGAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Breckenridge DG, Kang BH, Kokel D, Mitani S, Staehelin LA, Xue D.
Caenorhabditis elegans drp-1 and fis-2 regulate distinct cell-death execution pathways downstream of ced-3 and independent of ced-9.
Mol. Cell 2008 31(4) 586-97 
[ PubMed ID = 18722182 ] [ RRC reference ]