Home > Mutants (Isolated) > tm1824

Mutants (Isolated)

Allele Name		tm1824
Allele Type		Normal
Sequence Name		C43H6.8
Gene Name		hlh-15
Worm Base	Allele Name	tm1824
	Gene Name	hlh-15
	Sequence	C43H6.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. K. Ashrafi: healthy, fertile and has altered fat content at L4 and adult stage. Dr. O. Hobert: ASE & AIY fate markers normal. Dr. T. Ishihara: normal cehmotaxis to diacetyl, isoamylalcohol and benzaldehyde.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		17822/17823-18685/18686 (863 bp deletion)
Chromosome		X
Putative gene structure		complement(join(17744..17888, 17939..18063))
Map position		-15.57
Balancer
Map position of balancer
Sequence of primers		ExtRev:GTTAGGTACATGCGTAGCAT,IntFwd:GGGTGCACTGTATATGTCTG,ExtFwd:CCCATAGCAATTGGGTGCAC,IntRev:GCGTAGCATACCTGGCACAA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Lin C, Shan Y, Wang Z, Peng H, Li R, Wang P, He J, Shen W, Wu Z, Guo M. Molecular and circuit mechanisms underlying avoidance of rapid cooling stimuli in C. elegans. Nat Commun 2024 15(1) 297  [ PubMed ID = 38182628 ] [ RRC reference ] Wang M, Witvliet D, Wu M, Kang L, Shao Z. Temperature regulates synaptic subcellular specificity mediated by inhibitory glutamate signaling. PLoS Genet 2021 17(1) e1009295  [ PubMed ID = 33428618 ] [ RRC reference ] Wen X, Chen YH, Li R, Ge MH, Yin SW, Wu JJ, Huang JH, Liu H, Wang PZ, Gross E, Wu ZX. Signal Decoding for Glutamate Modulating Egg Laying Oppositely in Caenorhabditiselegans under Varied Environmental Conditions. iScience 2020 23(10) 101588  [ PubMed ID = 33089099 ] [ RRC reference ] Luo S, Horvitz HR. The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage. Curr Biol 2017 27(5) 661-672  [ PubMed ID = 28238659 ] [ RRC reference ]