Mutants (Isolated)

tm1813

Allele Nametm1813
Sequence NameT07G12.6
CGC Namezim-1
Worm BaseAllele Name tm1813
CGC Name zim-1
Sequence T07G12.6
Phenotypehomozygous viable. Dr. A. Dernburg: Dr. A. Dernburg: Dev. Cell 11, 817 (2006). Dr. W. Hanna-Rose: Genetics 177, 1221 (2007).
Mutation site18979/18980-19460/19461 (481 bp deletion)
ChromosomeIV
Putative gene structurejoin(18656..18754, 18823..19547, 19722..20040)
Map position4.62
Balancer
Map position of balancer
Sequence of primersExtFwd:CAAGGAGATTGCTATGGCAG,IntRev:CGATGCCGACCGTTGATTTA,IntFwd:AGTGCAAGTGCAACATGCTG,ExtRev:CTGGTGACAACTATGGTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Davis-Roca AC, Muscat CC, Wignall SM.
Caenorhabditis elegans oocytes detect meiotic errors in the absence of canonical end-on kinetochore attachments.
J. Cell Biol. 2017 216(5) 1243-1253 
[ PubMed ID = 28356326 ] [ RRC reference ]

Bhalla N, Wynne DJ, Jantsch V, Dernburg AF.
ZHP-3 acts at crossovers to couple meiotic recombination with synaptonemal complex disassembly and bivalent formation in C. elegans.
PLoS Genet. 2008 4(10) e1000235 
[ PubMed ID = 18949042 ] [ RRC reference ]

Leopold LE, Heestand BN, Seong S, Shtessel L, Ahmed S.
Lack of pairing during meiosis triggers multigenerational transgene silencing in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(20) E2667-76 
[ PubMed ID = 25941370 ] [ RRC reference ]

Kasper DM, Wang G, Gardner KE, Johnstone TG, Reinke V.
The C. elegans SNAPc component SNPC-4 coats piRNA domains and is globally required for piRNA abundance.
Dev. Cell 2014 31(2) 145-58 
[ PubMed ID = 25373775 ] [ RRC reference ]

Jaramillo-Lambert A, Harigaya Y, Vitt J, Villeneuve A, Engebrecht J.
Meiotic errors activate checkpoints that improve gamete quality without triggering apoptosis in male germ cells.
Curr. Biol. 2010 20(23) 2078-89 
[ PubMed ID = 20970339 ] [ RRC reference ]

Phillips CM, Dernburg AF.
A family of zinc-finger proteins is required for chromosome-specific pairing and synapsis during meiosis in C. elegans.
Dev. Cell 2006 11(6) 817-29 
[ PubMed ID = 17141157 ] [ RRC reference ]

Sun H, Nelms BL, Sleiman SF, Chamberlin HM, Hanna-Rose W.
Modulation of Caenorhabditis elegans transcription factor activity by HIM-8 and the related Zinc-Finger ZIM proteins.
Genetics 2007 177(2) 1221-6 
[ PubMed ID = 17720937 ] [ RRC reference ]

Checchi PM, Engebrecht J.
Caenorhabditis elegans histone methyltransferase MET-2 shields the male X chromosome from checkpoint machinery and mediates meiotic sex chromosome inactivation.
PLoS Genet. 2011 7(9) e1002267 
[ PubMed ID = 21909284 ] [ RRC reference ]