Mutants (Isolated)

tm1812

Allele Nametm1812
Sequence NameY17D7A.1
CGC Namenhr-230
Worm BaseAllele Name tm1812
CGC Name nhr-230
Sequence Y17D7A.1
Phenotypehomozygous viable
Mutation site13210/13211-13687/13688 (477 bp deletion)
ChromosomeV
Putative gene structurejoin(12524..12657, 13954..14093, 14155..14207, 14251..14409)
Map position18.31
Balancer
Map position of balancer
Sequence of primersExtFwd:ATCCGCTTTCCGCCAGTCAT,IntFwd:CCGCCAGTCATATATGCATC,ExtRev:GGATGACTGACGCGCAGTAT,IntRev:ACGCGCAGTATGTCGCAGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Brejc K, Bian Q, Uzawa S, Wheeler BS, Anderson EC, King DS, Kranzusch PJ, Preston CG, Meyer BJ.
Dynamic Control of X Chromosome Conformation and Repression by a Histone H4K20 Demethylase.
Cell 2017 171(1) 85-102.e23 
[ PubMed ID = 28867287 ] [ RRC reference ]