Mutants (Isolated)

tm1810

Allele Nametm1810
Sequence NameY48A6C.3
CGC Namesup-35
Worm BaseAllele Name tm1810
CGC Name sup-35
Sequence Y48A6C.3
Phenotypehomozygous viable. Dr. R. Waterston: Dead eggs <10%.
Mutation site17724/17725-18465/18466 (741 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(16720..17322, 17374..17442, 18271..18388, 18432..18581, 18626..18684))
Map position6.04
Balancer
Map position of balancer
Sequence of primersExtFwd:TCGATATCGTTCGACGGGTC,IntFwd:GGGTCCATTTTGAGTGCGAG,ExtRev:GCGTTCCCGTTTCTGCACAC,IntRev:GTCTCCAAAGCAAAAGCGCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Mani K, Fay DS.
A mechanistic basis for the coordinated regulation of pharyngeal morphogenesis in Caenorhabditis elegans by LIN-35/Rb and UBC-18-ARI-1.
PLoS Genet. 2009 5(6) e1000510 
[ PubMed ID = 19521497 ] [ RRC reference ]

Polley SR, Kuzmanov A, Kuang J, Karpel J, Lažetić V, Karina EI, Veo BL, Fay DS.
Implicating SCF complexes in organogenesis in Caenorhabditis elegans.
Genetics 2014 196(1) 211-23 
[ PubMed ID = 24214340 ] [ RRC reference ]

Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J.
A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans.
Genetics 2012 191(3) 827-43 
[ PubMed ID = 22542967 ] [ RRC reference ]