Mutants (Isolated)

tm1805

Allele Nametm1805
Sequence NameW09G12.1
CGC Namedsl-2
Worm BaseAllele Name tm1805
CGC Name dsl-2
Sequence W09G12.1
Phenotypehomozygous viable
Mutation site1139/1140-1891/1892 (752 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(76..545, 1308..1435, 1970..2340))
Map position-21.18
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCCGTCAGGCATTCGCAGT,IntFwd:TGGTGCATCGTTCTCGCAAG,ExtRev:CCCAACCCTGTAGGCTTGTA,IntRev:TTGACCTGGCGTTTCCCGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
SorkaƧ A, DiIorio MA, O'Hern PJ, Baskoylu SN, Graham HK, Hart AC.
LIN-12/Notch Regulates GABA Signaling at the Caenorhabditis elegans Neuromuscular Junction.
G3 (Bethesda) 2018 8(8) 2825-2832 
[ PubMed ID = 29950427 ] [ RRC reference ]