Mutants (Isolated)

tm1802

Allele Nametm1802
Sequence NameR53.3
CGC Nameegl-43
Worm BaseAllele Name tm1802
CGC Name egl-43
Sequence R53.3
Phenotypelethal or sterile. Dr. P.W. Sternberg: Development 134, 669 (2007). Dr.A. Hajnal: Dev. Biol. 308, 187 (2007).
Mutation site18540/18541-ACT-19077/19078 (537 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurejoin(12631..12750, 14458..14559, 14615..14745, 16034..16195, 17196..17310, 17746..17931, 18385..18482, 18633..19137, 19275..19346, 19459..19599)
Map position1.82
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:CGTGCAATGCTCCTGGGCTA,IntRev:TGCGGGGGGTTACTGTAGCA,ExtRev:TTGTGGGGTGTCAGCGAGGT,IntFwd:ACCCCATAATCTCACAACAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Hwang BJ, Meruelo AD, Sternberg PW.
C. elegans EVI1 proto-oncogene, EGL-43, is necessary for Notch-mediated cell fate specification and regulates cell invasion.
Development 2007 134(4) 669-79 
[ PubMed ID = 17215301 ] [ RRC reference ]

Rimann I, Hajnal A.
Regulation of anchor cell invasion and uterine cell fates by the egl-43 Evi-1 proto-oncogene in Caenorhabditis elegans.
Dev. Biol. 2007 308(1) 187-95 
[ PubMed ID = 17573066 ] [ RRC reference ]