Allele Name | tm1802 |
Sequence Name | R53.3 |
CGC Name | egl-43 |
Worm Base | Allele Name |
tm1802
|
CGC Name |
egl-43
|
Sequence |
R53.3
|
Phenotype | lethal or sterile. Dr. P.W. Sternberg: Development 134, 669 (2007). Dr.A. Hajnal: Dev. Biol. 308, 187 (2007). |
Mutation site | 18540/18541-ACT-19077/19078 (537 bp deletion + 3 bp insertion) |
Chromosome | II |
Putative gene structure | join(12631..12750, 14458..14559, 14615..14745, 16034..16195, 17196..17310, 17746..17931, 18385..18482, 18633..19137, 19275..19346, 19459..19599) |
Map position | 1.82 |
Balancer | Not Yet Balanced |
Map position of balancer | |
Sequence of primers | ExtFwd:CGTGCAATGCTCCTGGGCTA,IntRev:TGCGGGGGGTTACTGTAGCA,ExtRev:TTGTGGGGTGTCAGCGAGGT,IntFwd:ACCCCATAATCTCACAACAG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Medwig-Kinney TN, Smith JJ, Palmisano NJ, Tank S, Zhang W, Matus DQ. A developmental gene regulatory network for C. elegans anchor cell invasion. Development 2020 147(1)
[ PubMed ID = 31806663 ]
[ RRC reference ]
|
Deng T, Stempor P, Appert A, Daube M, Ahringer J, Hajnal A, Lattmann E. The Caenorhabditis elegans homolog of the Evi1 proto-oncogene, egl-43, coordinates G1 cell cycle arrest with pro-invasive gene expression during anchor cell invasion. PLoS Genet 2020 16(3) e1008470
[ PubMed ID = 32203506 ]
[ RRC reference ]
|
Rimann I, Hajnal A. Regulation of anchor cell invasion and uterine cell fates by the egl-43 Evi-1 proto-oncogene in Caenorhabditis elegans. Dev Biol 2007 308(1) 187-95
[ PubMed ID = 17573066 ]
[ RRC reference ]
|
Hwang BJ, Meruelo AD, Sternberg PW. C. elegans EVI1 proto-oncogene, EGL-43, is necessary for Notch-mediated cell fate specification and regulates cell invasion. Development 2007 134(4) 669-79
[ PubMed ID = 17215301 ]
[ RRC reference ]
|
|