Mutants (Isolated)

tm1800

Allele Nametm1800
Sequence NameF33D4.1a
CGC Namenhr-8
Worm BaseAllele Name tm1800
CGC Name nhr-8
Sequence F33D4.1a
Phenotypehomozygous viable.
Mutation site36915/36916-37358/37359 (443 bp deletion)
ChromosomeIV
Putative gene structurejoin(36222..36302, 36851..36943, 36992..37284, 37610..37706, 37753..37960, 38164..38364, 38411..38881, 38929..38998, 39074..39242)
Map position3.42
BalancernT1
Map position of balancer
Sequence of primersExtFwd:TGGACGAGTCTCGAAGGTCT,IntFwd:GCCTCTTGACGCTGGTTTAA,ExtRev:ACACTGCTTGAATTGGAGTC,IntRev:GCGCAGCCATTTGGGCCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ménez C, Alberich M, Courtot E, Guegnard F, Blanchard A, Aguilaniu H, Lespine A.
The transcription factor NHR-8: A new target to increase ivermectin efficacy in nematodes.
PLoS Pathog 2019 15(2) e1007598 
[ PubMed ID = 30759156 ] [ RRC reference ]

Magner DB, Wollam J, Shen Y, Hoppe C, Li D, Latza C, Rottiers V, Hutter H, Antebi A.
The NHR-8 nuclear receptor regulates cholesterol and bile acid homeostasis in C. elegans.
Cell Metab 2013 18(2) 212-24 
[ PubMed ID = 23931753 ] [ RRC reference ]

Ludewig AH, Gimond C, Judkins JC, Thornton S, Pulido DC, Micikas RJ, Döring F, Antebi A, Braendle C, Schroeder FC.
Larval crowding accelerates C. elegans development and reduces lifespan.
PLoS Genet 2017 13(4) e1006717 
[ PubMed ID = 28394895 ] [ RRC reference ]