Mutants (Isolated)

tm1789

Allele Nametm1789
Sequence NameZK177.10
CGC Nametbx-35
Worm BaseAllele Name tm1789
CGC Name tbx-35
Sequence ZK177.10
Phenotypelethal or sterile. Dr. M. Maduro: Development 133, 3097-3106 (2006)
Mutation site23636/23637-24558/24559 (922 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(23366..23666, 23715..23959))
Map position-1.21
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:GGATCTAGACATTGCCTCAA,ExtFwd:CGGACCTCCTAGGGTAAACA,IntFwd:CCCAGCATGGAAAATGAGAG,ExtRev:ATCCATACTGCGCAGTCCCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Broitman-Maduro G, Lin KT, Hung WW, Maduro MF.
Specification of the C. elegans MS blastomere by the T-box factor TBX-35.
Development 2006 133(16) 3097-106 
[ PubMed ID = 16831832 ] [ RRC reference ]

Harrell JR, Goldstein B.
Internalization of multiple cells during C. elegans gastrulation depends on common cytoskeletal mechanisms but different cell polarity and cell fate regulators.
Dev. Biol. 2011 350(1) 1-12 
[ PubMed ID = 20875815 ] [ RRC reference ]

Owraghi M, Broitman-Maduro G, Luu T, Roberson H, Maduro MF.
Roles of the Wnt effector POP-1/TCF in the C. elegans endomesoderm specification gene network.
Dev. Biol. 2010 340(2) 209-21 
[ PubMed ID = 19818340 ] [ RRC reference ]

Rasmussen JP, Feldman JL, Reddy SS, Priess JR.
Cell interactions and patterned intercalations shape and link epithelial tubes in C. elegans.
PLoS Genet. 2013 9(9) e1003772 
[ PubMed ID = 24039608 ] [ RRC reference ]