Mutants (Isolated)

tm1787

Allele Nametm1787
Sequence NameT12C9.1
CGC Namenhr-273
Worm BaseAllele Name tm1787
CGC Name nhr-273
Sequence T12C9.1
Phenotypehomozygous viable.
Mutation site5915/5916-6390/6391 (475 bp deletion)
ChromosomeII
Putative gene structurejoin(5528..5619, 5664..5749, 5988..6385, 6431..6615, 6711..7086)
Map position-4.42
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTGCCTTACAGCCGTACCT,IntFwd:AGTCGCAGAGCCATCAGTTA,ExtRev:GCGCTCATAGGATGGCTTGA,IntRev:GTCCCCAGATGGGAATGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fuxman Bass JI, Pons C, Kozlowski L, Reece-Hoyes JS, Shrestha S, Holdorf AD, Mori A, Myers CL, Walhout AJ.
A gene-centered C. elegans protein-DNA interaction network provides a framework for functional predictions.
Mol Syst Biol 2016 12(10) 884 
[ PubMed ID = 27777270 ] [ RRC reference ]