Mutants (Isolated)

tm1783

Allele Nametm1783
Sequence NameM03F4.7
CGC Namecalu-1
Worm BaseAllele Name tm1783
CGC Name calu-1
Sequence M03F4.7
Phenotypehomozygous viable. Dr. J. Ahnn: homozygous viable, 40% burst at vulva. Dr. A. Frand: molting defective.
Mutation site22677/22678-23146/23147 (469 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(21829..22029, 22081..22627, 22680..22783, 22839..22931))
Map position-6.2
Balancer
Map position of balancer
Sequence of primersIntFwd:TCGCGTAATACTGTTTGGAG,ExtFwd:AAGACATGGCGAAGTCGTAC,IntRev:CCCGCATAGTCTCTCCAATG,ExtRev:CTACTCCCGCCGCAGTCTTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cho JY, Choi TW, Kim SH, Ahnn J, Lee SK.
Morphological Characterization of small, dumpy, and long Phenotypes in Caenorhabditis elegans.
Mol Cells 2021 44(3) 160-167 
[ PubMed ID = 33692220 ] [ RRC reference ]

Cho JH, Song HO, Singaravelu G, Sung H, Oh WC, Kwon S, Kim DH, Ahnn J.
Pleiotropic roles of calumenin (calu-1), a calcium-binding ER luminal protein, in Caenorhabditis elegans.
FEBS Lett 2009 583(18) 3050-6 
[ PubMed ID = 19695248 ] [ RRC reference ]