Home > Mutants (Isolated) > tm1783

Mutants (Isolated)

Allele Name		tm1783
Allele Type		Normal
Sequence Name		M03F4.7
Gene Name		calu-1
Worm Base	Allele Name	tm1783
	Gene Name	calu-1
	Sequence	M03F4.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. J. Ahnn: homozygous viable, 40% burst at vulva. Dr. A. Frand: molting defective.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		22677/22678-23146/23147 (469 bp deletion)
Chromosome		X
Putative gene structure		complement(join(21829..22029, 22081..22627, 22680..22783, 22839..22931))
Map position		-6.2
Balancer		tmC30[tmIs1243]
Map position of balancer
Sequence of primers		IntFwd:TCGCGTAATACTGTTTGGAG,ExtFwd:AAGACATGGCGAAGTCGTAC,IntRev:CCCGCATAGTCTCTCCAATG,ExtRev:CTACTCCCGCCGCAGTCTTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Lee KE, Cho JH, Song HO. Calumenin, a Ca2+ Binding Protein, Is Required for Dauer Formation in Caenorhabditis elegans. Biology (Basel) 2023 12(3)   [ PubMed ID = 36979156 ] [ RRC reference ] Cho JY, Choi TW, Kim SH, Ahnn J, Lee SK. Morphological Characterization of small, dumpy, and long Phenotypes in Caenorhabditis elegans. Mol Cells 2021 44(3) 160-167  [ PubMed ID = 33692220 ] [ RRC reference ] Cho JH, Song HO, Singaravelu G, Sung H, Oh WC, Kwon S, Kim DH, Ahnn J. Pleiotropic roles of calumenin (calu-1), a calcium-binding ER luminal protein, in Caenorhabditis elegans. FEBS Lett 2009 583(18) 3050-6  [ PubMed ID = 19695248 ] [ RRC reference ]