Mutants (Isolated)

tm1781

Allele Nametm1781
Sequence NameH14E04.1
CGC NameH14E04.1
Worm BaseAllele Name tm1781
CGC Name H14E04.1
Sequence H14E04.1
Phenotypehomozygous viable
Mutation site34364/34365-35101/35102 (737 bp deletion)
ChromosomeIII
Putative gene structurejoin(33264..33326, 34411..34601, 35052..35194, 35422..35499, 35942..36111, 36508..36703, 37258..37421)
Map position-14.49
Balancer
Map position of balancer
Sequence of primersExtRev:CACGCGTATTCCAGATGATG,IntRev:CTGCGGGACCCGAAAACTCA,ExtFwd:TACGCAAACACCGATTACGA,IntFwd:CGGCGCGAAAATTGGGGTTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Martin R, Entchev EV, Kurzchalia TV, Knölker HJ.
Steroid hormones controlling the life cycle of the nematode Caenorhabditis elegans: stereoselective synthesis and biology.
Org. Biomol. Chem. 2010 8(4) 739-50 
[ PubMed ID = 20135027 ] [ RRC reference ]

Mahanti P, Bose N, Bethke A, Judkins JC, Wollam J, Dumas KJ, Zimmerman AM, Campbell SL, Hu PJ, Antebi A, Schroeder FC.
Comparative metabolomics reveals endogenous ligands of DAF-12, a nuclear hormone receptor, regulating C. elegans development and lifespan.
Cell Metab. 2014 19(1) 73-83 
[ PubMed ID = 24411940 ] [ RRC reference ]

Hannich JT, Entchev EV, Mende F, Boytchev H, Martin R, Zagoriy V, Theumer G, Riezman I, Riezman H, Knölker HJ, Kurzchalia TV.
Methylation of the sterol nucleus by STRM-1 regulates dauer larva formation in Caenorhabditis elegans.
Dev. Cell 2009 16(6) 833-43 
[ PubMed ID = 19531354 ] [ RRC reference ]