Mutants (Isolated)

tm1770

Allele Nametm1770
Sequence NameK11G9.6
CGC Namemtl-1
Worm BaseAllele Name tm1770
CGC Name mtl-1
Sequence K11G9.6
Phenotypehomozygous viable. Dr. C. Kenyon: no delay of developmental timing, normal in dauer test. Dr. I. Mori: normal thermotaxis when cultured at 23 C. Dr. M. Herman: life span change by some bacteria.
Mutation site21423/21424-22002/22003 (579 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(21470..21681, 21802..21817))
Map position0.13
Balancer
Map position of balancer
Sequence of primersExtRev:TAGATGTTTCAGACGTCACC,IntRev:CCTGTGGAGAAACGTGTAAG,ExtFwd:TGACCAGTGTCGTGAGCGAC,IntFwd:CAGGGTTTCATAGTCGGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cui Y, McBride SJ, Boyd WA, Alper S, Freedman JH.
Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity.
Genome Biol. 2007 8(6) R122 
[ PubMed ID = 17592649 ] [ RRC reference ]

Hall JA, McElwee MK, Freedman JH.
Identification of ATF-7 and the insulin signaling pathway in the regulation of metallothionein in C. elegans suggests roles in aging and reactive oxygen species.
PLoS ONE 2017 12(6) e0177432 
[ PubMed ID = 28632756 ] [ RRC reference ]

Zhao L, Rui Q, Wang D.
Molecular basis for oxidative stress induced by simulated microgravity in nematode Caenorhabditis elegans.
Sci. Total Environ. 2017 607-608 1381-1390 
[ PubMed ID = 28738528 ] [ RRC reference ]

Smolentseva O, Gusarov I, Gautier L, Shamovsky I, DeFrancesco AS, Losick R, Nudler E.
Mechanism of biofilm-mediated stress resistance and lifespan extension in C. elegans.
Sci Rep 2017 7(1) 7137 
[ PubMed ID = 28769037 ] [ RRC reference ]

Höckner M, Dallinger R, Stürzenbaum SR.
Nematode and snail metallothioneins.
J. Biol. Inorg. Chem. 2011 16(7) 1057-65 
[ PubMed ID = 21822727 ] [ RRC reference ]

Helmcke KJ, Aschner M.
Hormetic effect of methylmercury on Caenorhabditis elegans.
Toxicol. Appl. Pharmacol. 2010 248(2) 156-64 
[ PubMed ID = 20691719 ] [ RRC reference ]

Ye B, Rui Q, Wu Q, Wang D.
Metallothioneins are required for formation of cross-adaptation response to neurobehavioral toxicity from lead and mercury exposure in nematodes.
PLoS ONE 2010 5(11) e14052 
[ PubMed ID = 21124968 ] [ RRC reference ]

Jiang GC, Hughes S, Stürzenbaum SR, Evje L, Syversen T, Aschner M.
Caenorhabditis elegans metallothioneins protect against toxicity induced by depleted uranium.
Toxicol. Sci. 2009 111(2) 345-54 
[ PubMed ID = 19617453 ] [ RRC reference ]

Zeitoun-Ghandour S, Charnock JM, Hodson ME, Leszczyszyn OI, Blindauer CA, Stürzenbaum SR.
The two Caenorhabditis elegans metallothioneins (CeMT-1 and CeMT-2) discriminate between essential zinc and toxic cadmium.
FEBS J. 2010 277(11) 2531-42 
[ PubMed ID = 20553489 ] [ RRC reference ]

Dalton HM, Curran SP.
Hypodermal responses to protein synthesis inhibition induce systemic developmental arrest and AMPK-dependent survival in Caenorhabditis elegans.
PLoS Genet. 2018 14(7) e1007520 
[ PubMed ID = 30020921 ] [ RRC reference ]

Hughes S, Stürzenbaum SR.
Single and double metallothionein knockout in the nematode C. elegans reveals cadmium dependent and independent toxic effects on life history traits.
Environ. Pollut. 2007 145(2) 395-400 
[ PubMed ID = 17141712 ] [ RRC reference ]

Polak N, Read DS, Jurkschat K, Matzke M, Kelly FJ, Spurgeon DJ, Stürzenbaum SR.
Metalloproteins and phytochelatin synthase may confer protection against zinc oxide nanoparticle induced toxicity in Caenorhabditis elegans.
Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2014 160 75-85 
[ PubMed ID = 24333255 ] [ RRC reference ]

Hughes SL, Bundy JG, Want EJ, Kille P, Stürzenbaum SR.
The metabolomic responses of Caenorhabditis elegans to cadmium are largely independent of metallothionein status, but dominated by changes in cystathionine and phytochelatins.
J. Proteome Res. 2009 8(7) 3512-9 
[ PubMed ID = 19466807 ] [ RRC reference ]

Wu Q, Zhao Y, Li Y, Wang D.
Molecular signals regulating translocation and toxicity of graphene oxide in the nematode Caenorhabditis elegans.
Nanoscale 2014 6(19) 11204-12 
[ PubMed ID = 25124895 ] [ RRC reference ]

Hall J, Haas KL, Freedman JH.
Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans.
Toxicol. Sci. 2012 128(2) 418-26 
[ PubMed ID = 22552775 ] [ RRC reference ]

Sugi T, Nishida Y, Mori I.
Regulation of behavioral plasticity by systemic temperature signaling in Caenorhabditis elegans.
Nat. Neurosci. 2011 14(8) 984-92 
[ PubMed ID = 21706021 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]