Home > Mutants (Isolated) > tm1768

Mutants (Isolated)

Allele Name		tm1768
Allele Type		Normal
Sequence Name		M05B5.5a
Gene Name		hlh-2
Worm Base	Allele Name	tm1768
	Gene Name	hlh-2
	Sequence	M05B5.5a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. B. Conradt: 3% NSM sister cell survival at 20?C, sterile at 25?C. Dr. J. Kimble: Dev. Biol. 331, 14 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		[C01H6] 1369/1370-TAAAGCCAACAACAGCTTA-[C01H6] 1999/2000 (630 bp deletion + 19 bp insertion)
Chromosome		I
Putative gene structure		join(complement(Z71258.1:1959..2103), complement(Z71258.1:1121..1608), complement(Z71258.1:106..281), complement(19019..19144), complement(18765..18906), complement(18475..18597))
Map position		1.83
Balancer
Map position of balancer
Sequence of primers		IntFwd:AGTGTGGGCTCATACCGGCT,IntRev:GCTCCAGCCCAATTCCCTAC,ExtFwd:TCCTGGTGGCATTCCGGTCA,ExtRev:GGGATGTCATCCATCCGATA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Zhang A, Noma K, Yan D. Regulation of Gliogenesis by lin-32/Atoh1 in Caenorhabditis elegans. G3 (Bethesda) 2020 10(9) 3271-3278  [ PubMed ID = 32665354 ] [ RRC reference ] Rossillo M, Ringstad N. Development of specialized sensory neurons engages a nuclear receptor required for functional plasticity. Genes Dev 2020 34(23-24) 1666-1679  [ PubMed ID = 33184226 ] [ RRC reference ] Lee J, Taylor CA, Barnes KM, Shen A, Stewart EV, Chen A, Xiang YK, Bao Z, Shen K. A Myt1 family transcription factor defines neuronal fate by repressing non-neuronal genes. Elife 2019 8   [ PubMed ID = 31386623 ] [ RRC reference ] Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM. Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors. PLoS Genet 2016 12(8) e1006237  [ PubMed ID = 27487365 ] [ RRC reference ] Luo S, Horvitz HR. The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage. Curr Biol 2017 27(5) 661-672  [ PubMed ID = 28238659 ] [ RRC reference ] Rojo Romanos T, Pladevall-Morera D, Langebeck-Jensen K, Hansen S, Ng L, Pocock R. LIN-32/Atonal Controls Oxygen Sensing Neuron Development in Caenorhabditis elegans. Sci Rep 2017 7(1) 7294  [ PubMed ID = 28779171 ] [ RRC reference ] Schindler AJ, Sherwood DR. The transcription factor HLH-2/E/Daughterless regulates anchor cell invasion across basement membrane in C. elegans. Dev Biol 2011 357(2) 380-91  [ PubMed ID = 21784067 ] [ RRC reference ] Philogene MC, Small SG, Wang P, Corsi AK. Distinct Caenorhabditis elegans HLH-8/twist-containing dimers function in the mesoderm. Dev Dyn 2012 241(3) 481-92  [ PubMed ID = 22275075 ] [ RRC reference ] Zhu Z, Liu J, Yi P, Tian D, Chai Y, Li W, Ou G. A proneural gene controls C. elegans neuroblast asymmetric division and migration. FEBS Lett 2014 588(7) 1136-43  [ PubMed ID = 24589937 ] [ RRC reference ] Sallee MD, Greenwald I. Dimerization-driven degradation of C. elegans and human E proteins. Genes Dev 2015 29(13) 1356-61  [ PubMed ID = 26159995 ] [ RRC reference ] Chesney MA, Lam N, Morgan DE, Phillips BT, Kimble J. C. elegans HLH-2/E/Daughterless controls key regulatory cells during gonadogenesis. Dev Biol 2009 331(1) 14-25  [ PubMed ID = 19376107 ] [ RRC reference ]