Mutants (Isolated)

tm1765

Allele Nametm1765
Sequence NameC38C10.1
CGC Nametkr-1
Worm BaseAllele Name tm1765
CGC Name tkr-1
Sequence C38C10.1
Phenotypehomozygous viable. Dr. G. Hermann: wild-type gut granules. Dr. K. Ashrafi: no fat phenotype.
Mutation site16274/16275-17008/17009 (734 bp deletion)
ChromosomeIII
Putative gene structurejoin(15877..15899, 16023..16322, 16388..16511, 16573..16652, 16699..16846, 17267..17457, 17511..17689, 17740..17819)
Map position0.49
Balancer
Map position of balancer
Sequence of primersIntFwd:TTTTACGAATCACTGGGCTG,ExtFwd:GACAGAAAGCCTACACCCAA,IntRev:GTACCGGAAGCCAATGCGGA,ExtRev:CCATCGGAAGACGTACCGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J. Neurosci. 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J. Neurosci. 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]