Mutants (Isolated)

tm1762

Allele Nametm1762
Sequence NameY106G6E.6
CGC Namecsnk-1
Worm BaseAllele Name tm1762
CGC Name csnk-1
Sequence Y106G6E.6
Phenotypelethal or sterile. Dr. H. Sawa: homozygotes are early larval lethal.
Mutation site29644/29645-30883/30884 (1239 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(28521..28676, 29040..29098, 29149..29203, 29259..29665, 29934..30087, 30578..30726, 30785..30941, 31359..31445))
Map position4.77
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:GACTTTCAGCTCTCCACGGT,ExtRev:AGTGCTTATGGTCGGACCCA,IntRev:GCGACGGATTAGACATTTAG,IntFwd:CTGACGTATGAAGGGAACCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Flynn JR, McNally FJ.
A casein kinase 1 prevents expulsion of the oocyte meiotic spindle into a polar body by regulating cortical contractility.
Mol. Biol. Cell 2017 28(18) 2410-2419 
[ PubMed ID = 28701347 ] [ RRC reference ]