Mutants (Isolated)

tm1761

Allele Nametm1761
Sequence NameF37D6.1
CGC Namemus-101
Worm BaseAllele Name tm1761
CGC Name mus-101
Sequence F37D6.1
Phenotypelethal or sterile
Mutation site7904/7905-8500/8501 (596 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(3753..3878, 3924..4115, 4247..4606, 4658..4810, 4945..5152, 5547..6091, 6141..6327, 6380..6542, 7002..7245, 7293..7443, 7494..7781, 8101..8333, 8387..8530, 8581..8824, 8885..9021, 9072..9203, 9255..9304, 9856..9982))
Map position5.05
BalancerhT2
Map position of balancer
Sequence of primersExtRev:TCGCATTTCACACGCGCGAA,IntRev:ACCCTACCCTGCCAATTCTT,ExtFwd:ACTCGTCGACTCCACATATA,IntFwd:CGAAGTTCATCGATAGGATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Benkemoun L, Descoteaux C, Chartier NT, Pintard L, Labbé JC.
PAR-4/LKB1 regulates DNA replication during asynchronous division of the early C. elegans embryo.
J. Cell Biol. 2014 205(4) 447-55 
[ PubMed ID = 24841566 ] [ RRC reference ]

Jaramillo-Lambert A, Fuchsman AS, Fabritius AS, Smith HE, Golden A.
Rapid and Efficient Identification of Caenorhabditis elegans Legacy Mutations Using Hawaiian SNP-Based Mapping and Whole-Genome Sequencing.
G3 (Bethesda) 2015 5(5) 1007-19 
[ PubMed ID = 25740937 ] [ RRC reference ]