Mutants (Isolated)

tm1755

Allele Nametm1755
Sequence NameC42D8.4
CGC Nameets-5
Worm BaseAllele Name tm1755
CGC Name ets-5
Sequence C42D8.4
Phenotypehomozygous viable
Mutation site2374/2375-GTGT-2874/2875 (500 bp deletion + 4 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(830..895, 943..1052, 1105..1243, 2314..2386, 2436..2674))
Map position-6.2
Balancer
Map position of balancer
Sequence of primersExtRev:CTGGGGGTAAGCCTATCATA,IntRev:GATTAAATCCTCGCCGACGA,ExtFwd:GGATGCTGCCACATTGTCGG,IntFwd:TTAGTGACGATGCAGGAGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sharabi K, Charar C, Friedman N, Mizrahi I, Zaslaver A, Sznajder JI, Gruenbaum Y.
The response to high CO2 levels requires the neuropeptide secretion component HID-1 to promote pumping inhibition.
PLoS Genet. 2014 10(8) e1004529 
[ PubMed ID = 25101962 ] [ RRC reference ]

Guillermin ML, Castelletto ML, Hallem EA.
Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor.
Genetics 2011 189(4) 1327-39 
[ PubMed ID = 21954162 ] [ RRC reference ]