Mutants (Isolated)

tm1755

Allele Nametm1755
Sequence NameC42D8.4
CGC Nameets-5
Worm BaseAllele Name tm1755
CGC Name ets-5
Sequence C42D8.4
Phenotypehomozygous viable
Mutation site2374/2375-GTGT-2874/2875 (500 bp deletion + 4 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(830..895, 943..1052, 1105..1243, 2314..2386, 2436..2674))
Map position-6.2
Balancer
Map position of balancer
Sequence of primersExtRev:CTGGGGGTAAGCCTATCATA,IntRev:GATTAAATCCTCGCCGACGA,ExtFwd:GGATGCTGCCACATTGTCGG,IntFwd:TTAGTGACGATGCAGGAGTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Guillermin ML, Castelletto ML, Hallem EA.
Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor.
Genetics 2011 189(4) 1327-39 
[ PubMed ID = 21954162 ] [ RRC reference ]

Sharabi K, Charar C, Friedman N, Mizrahi I, Zaslaver A, Sznajder JI, Gruenbaum Y.
The response to high CO2 levels requires the neuropeptide secretion component HID-1 to promote pumping inhibition.
PLoS Genet. 2014 10(8) e1004529 
[ PubMed ID = 25101962 ] [ RRC reference ]