Mutants (Isolated)

tm1753

Allele Nametm1753
Sequence NameY18D10A.17
CGC Namecar-1
Worm BaseAllele Name tm1753
CGC Name car-1
Sequence Y18D10A.17
Phenotypelethal or sterile. Dr. K. Oegema: J. Cell Biol.171, 267-279 (2005). Dr. J.G. White: Mol. Biol. Cell, 17, 336-344 (2006).
Mutation site124580/124581-125218/125219 (638 bp deletion)
ChromosomeI
Putative gene structurejoin(124186..124431, 124482..124671, 124724..125167, 125215..125357)
Map position14.18
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:CCTTTAAATGGGATTGGGGT,IntFwd:GGGGTGCAGCGCCATTTTAG,ExtRev:ATATCGGGGTATGGGGATGT,IntRev:GGCAGTATTGCCTTGGTTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tang NH, Kim KW, Xu S, Blazie SM, Yee BA, Yeo GW, Jin Y, Chisholm AD.
The mRNA Decay Factor CAR-1/LSM14 Regulates Axon Regeneration via Mitochondrial Calcium Dynamics.
Curr. Biol. 2020 30(5) 865-876.e7 
[ PubMed ID = 31983639 ] [ RRC reference ]

Ko S, Kawasaki I, Shim YH.
PAB-1, a Caenorhabditis elegans poly(A)-binding protein, regulates mRNA metabolism in germline by interacting with CGH-1 and CAR-1.
PLoS ONE 2013 8(12) e84798 
[ PubMed ID = 24367695 ] [ RRC reference ]

Mikeladze-Dvali T, von Tobel L, Strnad P, Knott G, Leonhardt H, Schermelleh L, Gönczy P.
Analysis of centriole elimination during C. elegans oogenesis.
Development 2012 139(9) 1670-9 
[ PubMed ID = 22492357 ] [ RRC reference ]

Squirrell JM, Eggers ZT, Luedke N, Saari B, Grimson A, Lyons GE, Anderson P, White JG.
CAR-1, a protein that localizes with the mRNA decapping component DCAP-1, is required for cytokinesis and ER organization in Caenorhabditis elegans embryos.
Mol. Biol. Cell 2006 17(1) 336-44 
[ PubMed ID = 16267265 ] [ RRC reference ]

Audhya A, Hyndman F, McLeod IX, Maddox AS, Yates JR 3rd, Desai A, Oegema K.
A complex containing the Sm protein CAR-1 and the RNA helicase CGH-1 is required for embryonic cytokinesis in Caenorhabditis elegans.
J. Cell Biol. 2005 171(2) 267-79 
[ PubMed ID = 16247027 ] [ RRC reference ]

Noble SL, Allen BL, Goh LK, Nordick K, Evans TC.
Maternal mRNAs are regulated by diverse P body-related mRNP granules during early Caenorhabditis elegans development.
J. Cell Biol. 2008 182(3) 559-72 
[ PubMed ID = 18695046 ] [ RRC reference ]