Mutants (Isolated)

tm1750

Allele Nametm1750
Sequence NameZK256.1
CGC Namepmr-1
Worm BaseAllele Name tm1750
CGC Name pmr-1
Sequence ZK256.1
Phenotypehomozygous viable
Mutation site[CC4] 23461/23462-[CC4] 23714/23715 (253 bp deletion)
ChromosomeI
Putative gene structurejoin(Z81490.1:23740..24051, Z81490.1:24897..25127, Z81490.1:25190..25465, Z81490.1:26681..27254, Z81490.1:30707..31009, Z81490.1:31777..32063, 104..201, 1046..1310, 1948..2188, 2734..2852)
Map position17.16
Balancer
Map position of balancer
Sequence of primersExtFwd:GACGGCGGCAATATTCCGAG,IntFwd:CCGAGTACAAGGTAACACTA,ExtRev:CCCATGAAGGCGATGCATGT,IntRev:CAACATCGGATCCGGTGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Praitis V, Simske J, Kniss S, Mandt R, Imlay L, Feddersen C, Miller MB, Mushi J, Liszewski W, Weinstein R, Chakravorty A, Ha DG, Schacht Farrell A, Sullivan-Wilson A, Stock T.
The secretory pathway calcium ATPase PMR-1/SPCA1 has essential roles in cell migration during Caenorhabditis elegans embryonic development.
PLoS Genet. 2013 9(5) e1003506 
[ PubMed ID = 23696750 ] [ RRC reference ]

Kourtis N, Nikoletopoulou V, Tavernarakis N.
Small heat-shock proteins protect from heat-stroke-associated neurodegeneration.
Nature 2012 490(7419) 213-8 
[ PubMed ID = 22972192 ] [ RRC reference ]