Mutants (Isolated)

tm1748

Allele Nametm1748
Sequence NameF54D5.1
CGC Namepcs-1
Worm BaseAllele Name tm1748
CGC Name pcs-1
Sequence F54D5.1
Phenotypehomozygous viable
Mutation site36918/36919-AAA-37506/37507 (588 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(35625..36355, 36408..36493, 36763..36874, 36933..37119))
Map position3.77
Balancer
Map position of balancer
Sequence of primersExtFwd:TCTTTAAAGGCGCATCCCGT,IntFwd:TTTCGAATGGCCACGCTATG,ExtRev:ATGCTACTACCATGCGGGAC,IntRev:CATGCCGACTCGAGCTGTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schwartz MS, Benci JL, Selote DS, Sharma AK, Chen AG, Dang H, Fares H, Vatamaniuk OK.
Detoxification of multiple heavy metals by a half-molecule ABC transporter, HMT-1, and coelomocytes of Caenorhabditis elegans.
PLoS ONE 2010 5(3) e9564 
[ PubMed ID = 20221439 ] [ RRC reference ]

Turner EA, Kroeger GL, Arnold MC, Thornton BL, Di Giulio RT, Meyer JN.
Assessing different mechanisms of toxicity in mountaintop removal/valley fill coal mining-affected watershed samples using Caenorhabditis elegans.
PLoS ONE 2013 8(9) e75329 
[ PubMed ID = 24066176 ] [ RRC reference ]

Polak N, Read DS, Jurkschat K, Matzke M, Kelly FJ, Spurgeon DJ, St├╝rzenbaum SR.
Metalloproteins and phytochelatin synthase may confer protection against zinc oxide nanoparticle induced toxicity in Caenorhabditis elegans.
Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2014 160 75-85 
[ PubMed ID = 24333255 ] [ RRC reference ]

Hughes SL, Bundy JG, Want EJ, Kille P, St├╝rzenbaum SR.
The metabolomic responses of Caenorhabditis elegans to cadmium are largely independent of metallothionein status, but dominated by changes in cystathionine and phytochelatins.
J. Proteome Res. 2009 8(7) 3512-9 
[ PubMed ID = 19466807 ] [ RRC reference ]

Hall J, Haas KL, Freedman JH.
Role of MTL-1, MTL-2, and CDR-1 in mediating cadmium sensitivity in Caenorhabditis elegans.
Toxicol. Sci. 2012 128(2) 418-26 
[ PubMed ID = 22552775 ] [ RRC reference ]