Allele Name | tm1746 |
Sequence Name | B0414.5 |
CGC Name | cpb-3 |
Worm Base | Allele Name |
tm1746
|
CGC Name |
cpb-3
|
Sequence |
B0414.5
|
Phenotype | homozygous viable. Dr. J. Kimble: homozygotes are viable and fertile. Dr. M. Hengartner, Dr. D. Greenstein: increased germ cell apoptosis. |
Mutation site | 19085/19086-19653/19654 (568 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(17581..17792, 17868..18080, 18157..18757, 18814..18990, 19035..19964, 20012..20134)) |
Map position | 0.45 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:GTGTGCTGACTGCGAATTAC,ExtFwd:CCGACAGAAACAGTGTGCTG,IntRev:GTGTAACATCGCGTCGTTCA,ExtRev:ACGATGCCCACTCGATAATA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Kisielnicka E, Minasaki R, Eckmann CR. MAPK signaling couples SCF-mediated degradation of translational regulators to oocyte meiotic progression. Proc Natl Acad Sci U S A 2018 115(12) E2772-E2781
[ PubMed ID = 29496961 ]
[ RRC reference ]
|
Zanetti S, Puoti A. Sex determination in the Caenorhabditis elegans germline. Adv Exp Med Biol 2013 757 41-69
[ PubMed ID = 22872474 ]
[ RRC reference ]
|
Brear AG, Yoon J, Wojtyniak M, Sengupta P. Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia. Genetics 2014 197(2) 667-84
[ PubMed ID = 24646679 ]
[ RRC reference ]
|
Hasegawa E, Karashima T, Sumiyoshi E, Yamamoto M. C. elegans CPB-3 interacts with DAZ-1 and functions in multiple steps of germline development. Dev Biol 2006 295(2) 689-99
[ PubMed ID = 16678151 ]
[ RRC reference ]
|
|