Mutants (Isolated)

tm1734

Allele Nametm1734
Sequence NameC42D8.4
CGC Nameets-5
Worm BaseAllele Name tm1734
CGC Name ets-5
Sequence C42D8.4
Phenotypehomozygous viable. Dr. O. Hobert: Nature. 2009 458:885.
Mutation site2369/2370-2887/2888 (518 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(830..895, 943..1052, 1105..1243, 2314..2386, 2436..2674))
Map position-6.2
Balancer
Map position of balancer
Sequence of primersExtRev:CTGGGGGTAAGCCTATCATA,IntRev:GATTAAATCCTCGCCGACGA,ExtFwd:CGATCACATCGCGATGTTAT,IntFwd:GTACTTCAAATACAGACCGC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Serrano-Saiz E, Poole RJ, Felton T, Zhang F, De La Cruz ED, Hobert O.
Modular control of glutamatergic neuronal identity in C. elegans by distinct homeodomain proteins.
Cell 2013 155(3) 659-73 
[ PubMed ID = 24243022 ] [ RRC reference ]

Rojo Romanos T, Petersen JG, Riveiro AR, Pocock R.
A novel role for the zinc-finger transcription factor EGL-46 in the differentiation of gas-sensing neurons in Caenorhabditis elegans.
Genetics 2015 199(1) 157-63 
[ PubMed ID = 25395666 ] [ RRC reference ]

Gramstrup Petersen J, Rojo Romanos T, Juozaityte V, Redo Riveiro A, Hums I, Traunm├╝ller L, Zimmer M, Pocock R.
EGL-13/SoxD specifies distinct O2 and CO2 sensory neuron fates in Caenorhabditis elegans.
PLoS Genet. 2013 9(5) e1003511 
[ PubMed ID = 23671427 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6  
[ PubMed ID = 28422646 ] [ RRC reference ]

Sharabi K, Charar C, Friedman N, Mizrahi I, Zaslaver A, Sznajder JI, Gruenbaum Y.
The response to high CO2 levels requires the neuropeptide secretion component HID-1 to promote pumping inhibition.
PLoS Genet. 2014 10(8) e1004529 
[ PubMed ID = 25101962 ] [ RRC reference ]

Guillermin ML, Castelletto ML, Hallem EA.
Differentiation of carbon dioxide-sensing neurons in Caenorhabditis elegans requires the ETS-5 transcription factor.
Genetics 2011 189(4) 1327-39 
[ PubMed ID = 21954162 ] [ RRC reference ]

Flames N, Hobert O.
Gene regulatory logic of dopamine neuron differentiation.
Nature 2009 458(7240) 885-9 
[ PubMed ID = 19287374 ] [ RRC reference ]