Mutants (Isolated)

tm1730

Allele Nametm1730
Sequence NameT14G11.3
CGC Nameimmt-1
Worm BaseAllele Name tm1730
CGC Name immt-1
Sequence T14G11.3
Phenotypehomozygous viable. Dr. H-S. Koo: adult worms contain embryos later than 2-fold stage, morphological defects in mitochondria. Dr. A. van der Bliek: fertile, normal brood size. Gro, normal locomotion. Mitochondria are swollen and disorganized in muscle and hypodermal cells.
Mutation site7555/7556-8266/8267 (711 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(4707..4904, 5588..5854, 5941..6324, 6392..6616, 7046..7159, 7210..7329, 7798..8045, 8091..8299, 8352..8519, 8566..8654, 8719..8736))
Map position-13.93
Balancer
Map position of balancer
Sequence of primersExtFwd:CGTCACTCACTTTAGCGTGA,IntFwd:GGCGGTAGTTGAATCTCGCT,ExtRev:GTCGATATTAGGCTTAGGAC,IntRev:TATGGACCAGGTGTGCGATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mun JY, Lee TH, Kim JH, Yoo BH, Bahk YY, Koo HS, Han SS.
Caenorhabditis elegans mitofilin homologs control the morphology of mitochondrial cristae and influence reproduction and physiology.
J. Cell. Physiol. 2010 224(3) 748-56 
[ PubMed ID = 20578245 ] [ RRC reference ]

Head BP, Zulaika M, Ryazantsev S, van der Bliek AM.
A novel mitochondrial outer membrane protein, MOMA-1, that affects cristae morphology in Caenorhabditis elegans.
Mol. Biol. Cell 2011 22(6) 831-41 
[ PubMed ID = 21248201 ] [ RRC reference ]