Mutants (Isolated)

tm1729

Allele Nametm1729
Sequence NameF54A5.3
CGC Nameshc-1
Worm BaseAllele Name tm1729
CGC Name shc-1
Sequence F54A5.3
Phenotypehomozygous viable. Dr. K. Matsumoto: sensitive to copper.
Mutation site20469/20470-AT-20877/20878 (408 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(17770..17928, 17983..18073, 19550..20040, 20738..20810, 20957..21027, 21077..21142))
Map position-17.41
Balancer
Map position of balancer
Sequence of primersExtFwd:GGTGCTCGGCAATTCGACAC,IntFwd:AATGACTGTCGATGCAGGGA,ExtRev:GGTGACGTCTTCAGGCATAG,IntRev:ACTTCTAGGCCACCGGTCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mizuno T, Fujiki K, Sasakawa A, Hisamoto N, Matsumoto K.
Role of the Caenorhabditis elegans Shc adaptor protein in the c-Jun N-terminal kinase signaling pathway.
Mol. Cell. Biol. 2008 28(23) 7041-9 
[ PubMed ID = 18809575 ] [ RRC reference ]

Qi W, Huang X, Neumann-Haefelin E, Schulze E, Baumeister R.
Cell-nonautonomous signaling of FOXO/DAF-16 to the stem cells of Caenorhabditis elegans.
PLoS Genet. 2012 8(8) e1002836 
[ PubMed ID = 22916022 ] [ RRC reference ]