Mutants (Isolated)

tm1728

Allele Nametm1728
Sequence NameC09B7.1
CGC Nameser-7
Worm BaseAllele Name tm1728
CGC Name ser-7
Sequence C09B7.1
Phenotypehomozygous viable. Dr. R. Komuniecki: Genetics in press.
Mutation site42992/42993-T-43687/43688 (695 bp deletion + 1 bp insertion)
ChromosomeX
Putative gene structurejoin(36058..36389, 37087..37342, 40604..40933, 42388..42560, 43169..43306, 44163..44201, 44465..44504)
Map position-14.04
Balancer
Map position of balancer
Sequence of primersIntRev:CGCGGATTCTCTATCAATAG,ExtFwd:GGCCTGCCTTCCTGACATGT,IntFwd:ATCCTGGAGCTGGCGAGTTA,ExtRev:GACTGTAAACGCGCAGAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hobson RJ, Hapiak VM, Xiao H, Buehrer KL, Komuniecki PR, Komuniecki RW.
SER-7, a Caenorhabditis elegans 5-HT7-like receptor, is essential for the 5-HT stimulation of pharyngeal pumping and egg laying.
Genetics 2006 172(1) 159-69 
[ PubMed ID = 16204223 ] [ RRC reference ]

Carre-Pierrat M, Baillie D, Johnsen R, Hyde R, Hart A, Granger L, S├ęgalat L.
Characterization of the Caenorhabditis elegans G protein-coupled serotonin receptors.
Invert. Neurosci. 2006 6(4) 189-205 
[ PubMed ID = 17082916 ] [ RRC reference ]

Hapiak VM, Hobson RJ, Hughes L, Smith K, Harris G, Condon C, Komuniecki P, Komuniecki RW.
Dual excitatory and inhibitory serotonergic inputs modulate egg laying in Caenorhabditis elegans.
Genetics 2009 181(1) 153-63 
[ PubMed ID = 19001289 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]