Mutants (Isolated)

tm1725

Allele Nametm1725
Sequence NameT28F3.6
CGC Nameifta-2
Worm BaseAllele Name tm1725
CGC Name ifta-2
Sequence T28F3.6
Phenotypehomozygous viable
Mutation site20373/20374-20956/20957 (583 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(20593..20773, 20825..21028, 21205..21328, 21409..21544, 21656..21769))
Map position16.45
Balancer
Map position of balancer
Sequence of primersExtFwd:AACCTTCACTATCGGAGGCT,ExtRev:CTGCGTACCGGGAACTTTAG,IntFwd:TCGGAGGCTCTTGATTGGGT,IntRev:GTAGCCGGCGAGTTCACTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Schafer JC, Winkelbauer ME, Williams CL, Haycraft CJ, Desmond RA, Yoder BK.
IFTA-2 is a conserved cilia protein involved in pathways regulating longevity and dauer formation in Caenorhabditis elegans.
J. Cell. Sci. 2006 119(Pt 19) 4088-100 
[ PubMed ID = 16968739 ] [ RRC reference ]